The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.     

Gonadotropin-releasing hormone: one polypeptide regulates secretion of luteinizing and follicle-stimulating hormones

A polypeptide isolated from porcine hypothalami stimulates the release of both luteinizing hormone and follicle-stimulating hormone from the pituitaries of several species. This polypeptide has been structurally identified as (pyro)Glu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH(2) and synthesized. The natural and synthetic materials share biological properties. It appears that this peptide represents the hypothalamic hormone regulating the secretion of both luteinizing hormone and follicle-stimulating hormone.     

Control mechanism of the circadian clock for timing of cell division in vivo

Cell division in many mammalian tissues is associated with specific times of day, but just how the circadian clock controls this timing has not been clear. Here, we show in the regenerating liver (of mice) that the circadian clock controls the expression of cell cycle-related genes that in turn modulate the expression of active Cyclin B1-Cdc2 kinase, a key regulator of mitosis. Among these genes, expression of wee1 was directly regulated by the molecular components of the circadian clockwork. In contrast, the circadian clockwork oscillated independently of the cell cycle in single cells. Thus, the intracellular circadian clockwork can control the cell-division cycle directly and unidirectionally in proliferating cells.     

A planar rhombic charge-separated tetrasilacyclobutadiene

The cyclobutadiene (CBD) molecule C(4)H(4) deviates from a high-symmetry square geometry to compensate for its antiaromatic electronic structure. Here, we report a CBD silicon analog, Si(4)(EMind)(4) (1), stabilized by the bulky 1,1,7,7-tetraethyl-3,3,5,5-tetramethyl-s-hydrindacen-4-yl (EMind) groups, obtained as air- and moisture-sensitive orange crystals by the reduction of (EMind)SiBr(3) with three equivalents of lithium naphthalenide. X-ray crystallography reveals a planar and rhombic structure of the Si(4) four-membered ring, with alternating pyramidal and planar configurations at the silicon atoms. The large (29)Si chemical shift differences (Δδ > 350 parts per million) in the solid-state nuclear magnetic resonance spectra suggest a contribution of an alternately charge-separated structure. The rhombic-shaped charge-separated singlet state of compound 1 thus stabilizes its cyclic 4π-electron antiaromaticity in a manner that contrasts sharply with the bond-length alternation, characterizing the rectangular distortion of carbon-based CBD.     

Quantum criticality without tuning in the mixed valence compound beta-YbAlB4

Fermi liquid theory, the standard theory of metals, has been challenged by a number of observations of anomalous metallic behavior found in the vicinity of a quantum phase transition. The breakdown of the Fermi liquid is accomplished by fine-tuning the material to a quantum critical point by using a control parameter such as the magnetic field, pressure, or chemical composition. Our high-precision magnetization measurements of the ultrapure f-electron-based superconductor β-YbAlB(4) demonstrate a scaling of its free energy that is indicative of zero-field quantum criticality without tuning in a metal. The breakdown of Fermi liquid behavior takes place in a mixed-valence state, which is in sharp contrast with other known examples of quantum critical f-electron systems that are magnetic Kondo lattice systems with integral valence.     

Quantitative nested real-time PCR detection of <Emphasis Type="Italic">Verticillium longisporum</Emphasis> and <Emphasis Type="Italic">V. dahliae</Emphasis> in the soil of cabbage fields

Verticillium longisporum and V. dahliae, causal agents of Verticillium wilt, are spreading through the cabbage fields of Gunma Prefecture. Using the V. longisporum-specific intron within the 18S rDNA and differences between ITS 5.8S rDNA sequences in Japanese isolates of V. longisporum and V. dahliae, we developed three quantitative nested real-time (QNRT) PCR assays. The QNRT-PCR quantification of V. longisporum or V. dahliae in cabbage field soil was consistent with the severity of Verticillium wilt disease in those fields. In field trials of resistant cultivar YR Ranpo grown for three seasons in soil infested with the pathogen, disease severity and pathogen density in the soil were significantly reduced in a field moderately contaminated by V. dahliae, but only slightly reduced in a highly contaminated field. These results suggest that continuous cultivation of a resistant cultivar is an effective way to reduce the pathogen population. QNRT-PCR assays provide a powerful analytical tool to evaluate the soil population dynamics of V. longisporum and V. dahliae for disease management.     

2,4-Nonadienal and benzaldehyde bioantimutagens in Fushimi sweet pepper (Fushimi-togarashi)

Fushimi sweet pepper, "Fushimi-togarashi", is one of the "Kyo-yasai", traditional vegetables, in Kyoto, Japan. The chloroform fraction of Fushimi sweet pepper showed bioantimutagenicity on UV induced mutation in Escherichia coli B/r WP2. The bioantimutagen was purified with silica gel chromatography and identified as 2, 4-nonadienal (ID(50) = 20 microg/plate) on the basis of GC retention time and EI-MS spectrum of authentic 2,4-nonadienal. The sweet pepper also contained a known bioantimutagen, benzaldehyde (ID(50) = 2 mg/plate). Additive bioantimutagenicity was also observed by 2, 4-nonadienal with benzaldehyde. 2,4-Nonadienal did not show bioantimutagenicity in an UV excision repair deficient strain, E. coli B/r WP2s uvrA(-)(). Furthermore no delay of the first cell division after UV irradiation was observed in E. coli B/r WP2. These results indicate that the bioantimutagenic activity of 2, 4-nonadienal on UV mutagenesis might depend on the excision repair system in E. coli B/r WP2.     

The status of atmospheric concentrations of ammonia in an intensive dairy farming area in central Japan

(pp. 41–46)
Silicon availability in 36 commercial nursery bed soils was evaluated by four methods the phosphate buffer (pH 6.2, 40 mmol L⁻¹), incubation, supernatant and acetate buffer (pH 4.0, 1 mol L⁻¹) Methods. The influence of silicon availability in the nursery bed soils on the silicon uptake of rice Oryza sativa L. cv. Hitomebore seedlings and the effect of silicon fertilizer application were examined in a glass house in 2002.
The results revealed that the best correlation between silicon content in rice seedlings and available silicon in soils was obtained with the phosphate buffer-solution method ( r  = 0.86). More precise evaluation of available silicon was achieved by grouping soils based on these phosphate absorption coefficients (PAC). The correlation coefficients between silicon content in rice seedlings and available silicon in soils were 0.92 and 0.72 for volcanic soils (PAC > 1500) and non volcanic soils (PAC < 1500), respectively.
We concluded that the phosphate buffer method is the most easily adjusted method for estimation of silicon availability in nursery bed soils, and silicon fertilizers should be applied when silicon availability in non-volcanic nursery bed soils goes below 200 mg kg⁻¹, whereas the level is less than 350 mg kg⁻¹ in volcanic soils.     

Change of plasma insulin-like growth factor-1 (IGF-1) concentration with early growth in Japanese beef cattle

The aim of the present study was to examine the change in plasma insulin‐like growth factor‐1 (IGF‐1) concentration with early growth, changes of bodyweight (BW) and relative dairy gain (RDG) in the pre‐ (PRW) and postweaning periods (POW) in Japanese beef cattle, and relationships with metabolites. A total of 33 calves, 22 Japanese black, 6 Japanese shorthorn and 5 of their crossbreed were studied. Insulin‐like growth factor‐1 and metabolite (glucose, triacylglycerol, nonesterified fatty acid) levels in the plasma, from jugular vein blood taken every month, were measured along with BW. Insulin‐like growth factor‐1 in POW increased dramatically with increase of BW (P < 0.05), and the correlation was positive at 0.52 (P < 0.01). Glucose levels correlated significantly with BW, RDG and IGF‐1 (P < 0.01). Metabolic required calorie correlated positively with IGF‐1 (P < 0.01). Also, correlations of BW in POW, with BW and RDG in PRW were positive (P < 0.01). Growth in PRW would be influenced by maternal effects, while active self‐secretion of IGF‐1 in POW might contribute to POW growth. These factors suggested that to increase growth in PRW, maintaining enough maternal effect and IGF‐1 level in POW, was important for establishing better growth after weaning.